Notice: wp_enqueue_script was called incorrectly. Scripts and styles should not be registered or enqueued until the wp_enqueue_scripts, admin_enqueue_scripts, or login_enqueue_scripts hooks. Please see Debugging in WordPress for more information. (This message was added in version 3.3.0.) in /home/vigenebio.com/public_html/wp/wp-includes/functions.php on line 4903
pMIR-hsa-mir-5705-GFP, CR219553 | Vigene Biosciences

pMIR-hsa-mir-5705-GFP

Catalog number: CR219553
miRNA vector (pMIR) with CMV promoter-driven expression of human pre-miRNA hsa-mir-5705 and GFP reporter.
Vector: pMIR
Promoter: CMV
Tag: GFP
$298.00
-
+

Specifications

You are viewing
pMIR-hsa-mir-5705-GFP

What's in the box?
More Information
Item
Volume 500 µL
Pre-miRNA No. MI0019313
Pre-miRNA Name hsa-mir-5705
Pre-miRNA Sequence UCCCCAUUUACACAGGCCAUGAGCCCCGAAACACCCAUCCCAGGAUUGCUGAUGGGUGUUUCGGGGCUCAUGGCCUGUGUAAAUGGGGA
Mature miRNA 1 No. MIMAT0022499
Mature miRNA 1 Name hsa-miR-5705
Mature miRNA 1 Sequence UGUUUCGGGGCUCAUGGCCUGUG
Storage Buffer LB with 10% glycerol and 30 µg/mL Kanamycin
Storage Conditions -80°C
Shipping Ambient temperature
Use Restrictions
For Research Use Only. Not for Use in
Therapeutic or Diagnostic Procedures.
Storage Conditions
-80°C

Resources

Downloads
PDF (557.6 KB)
PNG (138.9 KB)
DNA (2 MB)
  1. pMIR-hsa-mir-5701-2-GFP
    miRNA vector (pMIR) with CMV promoter-driven expression of human pre-m
  2. pMIR-hsa-let-7a-1-GFP
    miRNA vector (pMIR) with CMV promoter-driven expression of human pre-m
  3. pMIR-hsa-let-7a-2-GFP
    miRNA vector (pMIR) with CMV promoter-driven expression of human pre-m
  4. pMIR-hsa-let-7a-3-GFP
    miRNA vector (pMIR) with CMV promoter-driven expression of human pre-m

Fatal error: Uncaught Exception: Notice: ob_end_flush(): failed to delete and flush buffer. No buffer to delete or flush in /home/vigenebio.com/public_html/wp/wp-content/themes/betheme-child/functions.php on line 1261 in /home/vigenebio.com/public_html/vendor/magento/framework/App/ErrorHandler.php:61 Stack trace: #0 [internal function]: Magento\Framework\App\ErrorHandler->handler(8, 'ob_end_flush():...', '/home/vigenebio...', 1261, Array) #1 /home/vigenebio.com/public_html/wp/wp-content/themes/betheme-child/functions.php(1261): ob_end_flush() #2 /home/vigenebio.com/public_html/wp/wp-includes/class-wp-hook.php(288): buffer_end('') #3 /home/vigenebio.com/public_html/wp/wp-includes/class-wp-hook.php(312): WP_Hook->apply_filters(NULL, Array) #4 /home/vigenebio.com/public_html/wp/wp-includes/plugin.php(478): WP_Hook->do_action(Array) #5 /home/vigenebio.com/public_html/wp/wp-includes/load.php(947): do_action('shutdown') #6 [internal function]: shutdown_action_hook() #7 {main} thrown in /home/vigenebio.com/public_html/vendor/magento/framework/App/ErrorHandler.php on line 61