pMIR-hsa-mir-1243-GFP

Catalog number: CR227083
miRNA vector (pMIR) with CMV promoter-driven expression of human pre-miRNA hsa-mir-1243 and GFP reporter.
Vector: pMIR
Promoter: CMV
Tag: GFP
$298.00
-
+

Specifications

You are viewing
pMIR-hsa-mir-1243-GFP

What's in the box?
More Information
Item
Volume 500 µL
Pre-miRNA No. MI0006373
Pre-miRNA Name hsa-mir-1243
Pre-miRNA Sequence CUAAAACUGGAUCAAUUAUAGGAGUGAAAUAAAGGUCCAUCUCCUGCCUAUUUAUUACUUUGCUUUGGUAAUAAAUCUAUUUUUAAAAGAACC
Mature miRNA 1 No. MIMAT0005894
Mature miRNA 1 Name hsa-miR-1243
Mature miRNA 1 Sequence AACUGGAUCAAUUAUAGGAGUG
Storage Buffer LB with 10% glycerol and 30 µg/mL Kanamycin
Storage Conditions -80°C
Shipping Ambient temperature
Use Restrictions
For Research Use Only. Not for Use in
Therapeutic or Diagnostic Procedures.
Storage Conditions
-80°C

Resources

Downloads
PDF (557.6 KB)
PNG (138.9 KB)
DNA (2 MB)
  1. pMIR-hsa-mir-5701-2-GFP
    miRNA vector (pMIR) with CMV promoter-driven expression of human pre-m
  2. pMIR-hsa-let-7a-1-GFP
    miRNA vector (pMIR) with CMV promoter-driven expression of human pre-m
  3. pMIR-hsa-let-7a-2-GFP
    miRNA vector (pMIR) with CMV promoter-driven expression of human pre-m
  4. pMIR-hsa-let-7a-3-GFP
    miRNA vector (pMIR) with CMV promoter-driven expression of human pre-m