pAV-SPINT4-shRNA

Catalog number: SH898568
Four pre-designed shRNA constructs targeting serine peptidase inhibitor, Kunitz type 4 (SPINT4) and one scrambled control. Each shRNA construct is driven by the U6 promoter and contains a GFP reporter.
Vector: pAV-U6-GFP
Promoter: U6
Tag: GFP
$595.00
-
+

Specifications

You are viewing
pAV-SPINT4-shRNA

What's in the box?
More Information
Item
Volume 5 µg
Gene Symbol SPINT4; C20orf137; dJ601O1.1; SPINT3
RefSeq NM_178455
Species Human
shRNA 1 AATACCCTGTTATTGGGTGGTGT
shRNA 2 AAGATATGTGGAGACCTCAAAGA
shRNA 3 AAAGATCCCTGCAAATTGGACAT
shRNA 4 AAGCTGCTATGAAGTTCACTTTA
Storage Buffer TE Buffer
Storage Conditions -20°C
Shipping Ambient temperature
Use Restrictions
For Research Use Only. Not for Use in
Therapeutic or Diagnostic Procedures.
Storage Conditions
-20°C

Resources

Downloads
PDF (557.6 KB)
PNG (126.9 KB)
DNA (5.2 MB)
  1. pAV-CD37v1-shRNA
    Four pre-designed shRNA constructs targeting CD37 molecule (CD37), tra
  2. pAV-SDR16C5-shRNA
    Four pre-designed shRNA constructs targeting short chain dehydrogenase
  3. pAV-ISYNA1v1-shRNA
    Four pre-designed shRNA constructs targeting inositol-3-phosphate synt
  4. pAV-TFCP2v3-shRNA
    Four pre-designed shRNA constructs targeting transcription factor CP2