pAV-SLC25A32-shRNA

Catalog number: SH888557
Four pre-designed shRNA constructs targeting solute carrier family 25, member 32 (SLC25A32), nuclear gene encoding mitochondrial protein and one scrambled control. Each shRNA construct is driven by the U6 promoter and contains a GFP reporter.
Vector: pAV-U6-GFP
Promoter: U6
Tag: GFP
$595.00
-
+

Specifications

You are viewing
pAV-SLC25A32-shRNA

What's in the box?
More Information
Item
Volume 5 µg
Gene Symbol SLC25A32; FLJ23872; MFT; MFTC
RefSeq NM_030780
Species Human
shRNA 1 AACTGAGACCGAAATATAATGGA
shRNA 2 AAACAGAAGGAAGAGCTGAACGT
shRNA 3 AACAGAATACCTTGTCTCAGCTG
shRNA 4 AATATATAAGTATGAAGGTGTGC
Storage Buffer TE Buffer
Storage Conditions -20°C
Shipping Ambient temperature
Use Restrictions
For Research Use Only. Not for Use in
Therapeutic or Diagnostic Procedures.
Storage Conditions
-20°C

Resources

Downloads
PDF (557.6 KB)
PNG (126.9 KB)
DNA (5.2 MB)
  1. pAV-CD37v1-shRNA
    Four pre-designed shRNA constructs targeting CD37 molecule (CD37), tra
  2. pAV-SDR16C5-shRNA
    Four pre-designed shRNA constructs targeting short chain dehydrogenase
  3. pAV-ISYNA1v1-shRNA
    Four pre-designed shRNA constructs targeting inositol-3-phosphate synt
  4. pAV-TFCP2v3-shRNA
    Four pre-designed shRNA constructs targeting transcription factor CP2