pAV-SLC22A5-shRNA

Catalog number: SH895053
Four pre-designed shRNA constructs targeting solute carrier family 22 (organic cation/carnitine transporter), member 5 (SLC22A5) and one scrambled control. Each shRNA construct is driven by the U6 promoter and contains a GFP reporter.
Vector pAV-U6-GFP
Promoter U6
Tag GFP
$595.00
-
+

Specifications

You are viewing
pAV-SLC22A5-shRNA

What's in the box?
More Information
Item
Volume 5 µg
Vector pAV-U6-GFP
Promoter U6
Gene Symbol SLC22A5; CDSP; FLJ46769; OCTN2; OCTN2VT
RefSeq NM_003060
Species Human
shRNA 1 CCTCATCTTCTTCCTGCTCAGCG
shRNA 2 GGCTGGGAGTTCAGTCAGGACGT
shRNA 3 TTTGTCCTGGGGACAGAAATTCT
shRNA 4 TTTGACCCGAGTGAGTTACAAGA
Storage Buffer TE Buffer
Storage Conditions -20°C
Shipping Ambient temperature
Use Restrictions
For Research Use Only. Not for Use in
Therapeutic or Diagnostic Procedures.
Storage Conditions
-20°C

Resources

Downloads
PDF (557.6 KB)
PNG (27.5 KB)
DNA (5.2 MB)
  1. pAV-CD37v1-shRNA
    Four pre-designed shRNA constructs targeting CD37 molecule (CD37), tra
  2. pAV-SDR16C5-shRNA
    Four pre-designed shRNA constructs targeting short chain dehydrogenase
  3. pAV-ISYNA1v1-shRNA
    Four pre-designed shRNA constructs targeting inositol-3-phosphate synt
  4. pAV-TFCP2v3-shRNA
    Four pre-designed shRNA constructs targeting transcription factor CP2