Notice: wp_enqueue_script was called incorrectly. Scripts and styles should not be registered or enqueued until the wp_enqueue_scripts, admin_enqueue_scripts, or login_enqueue_scripts hooks. Please see Debugging in WordPress for more information. (This message was added in version 3.3.0.) in /home/vigenebio.com/public_html/wp/wp-includes/functions.php on line 4903
pAV-ARL2v2-shRNA, SH891175 | Vigene Biosciences

pAV-ARL2v2-shRNA

Catalog number: SH891175
Four pre-designed shRNA constructs targeting ADP-ribosylation factor-like 2 (ARL2), transcript variant 2 and one scrambled control. Each shRNA construct is driven by the U6 promoter and contains a GFP reporter.
Vector: pAV-U6-GFP
Promoter: U6
Tag: GFP
$595.00
-
+

Specifications

You are viewing
pAV-ARL2v2-shRNA

What's in the box?
More Information
Item
Volume 5 µg
Gene Symbol ARL2
RefSeq NM_001199745
Species Human
shRNA 1 TTGGCCTGGACAATGCTGGAAAG
shRNA 2 TTCAATGGGGAGGACATCGACAC
shRNA 3 CCCTGGAGCACCGAGGATTCAAG
shRNA 4 GGAACTACTTTGAGAGCACCGAT
Storage Buffer TE Buffer
Storage Conditions -20°C
Shipping Ambient temperature
Use Restrictions
For Research Use Only. Not for Use in
Therapeutic or Diagnostic Procedures.
Storage Conditions
-20°C

Resources

Downloads
PDF (557.6 KB)
PNG (126.9 KB)
DNA (5.2 MB)
  1. pAV-CD37v1-shRNA
    Four pre-designed shRNA constructs targeting CD37 molecule (CD37), tra
  2. pAV-SDR16C5-shRNA
    Four pre-designed shRNA constructs targeting short chain dehydrogenase
  3. pAV-ISYNA1v1-shRNA
    Four pre-designed shRNA constructs targeting inositol-3-phosphate synt
  4. pAV-TFCP2v3-shRNA
    Four pre-designed shRNA constructs targeting transcription factor CP2

Fatal error: Uncaught Exception: Notice: ob_end_flush(): failed to delete and flush buffer. No buffer to delete or flush in /home/vigenebio.com/public_html/wp/wp-content/themes/betheme-child/functions.php on line 1261 in /home/vigenebio.com/public_html/vendor/magento/framework/App/ErrorHandler.php:61 Stack trace: #0 [internal function]: Magento\Framework\App\ErrorHandler->handler(8, 'ob_end_flush():...', '/home/vigenebio...', 1261, Array) #1 /home/vigenebio.com/public_html/wp/wp-content/themes/betheme-child/functions.php(1261): ob_end_flush() #2 /home/vigenebio.com/public_html/wp/wp-includes/class-wp-hook.php(288): buffer_end('') #3 /home/vigenebio.com/public_html/wp/wp-includes/class-wp-hook.php(312): WP_Hook->apply_filters(NULL, Array) #4 /home/vigenebio.com/public_html/wp/wp-includes/plugin.php(478): WP_Hook->do_action(Array) #5 /home/vigenebio.com/public_html/wp/wp-includes/load.php(947): do_action('shutdown') #6 [internal function]: shutdown_action_hook() #7 {main} thrown in /home/vigenebio.com/public_html/vendor/magento/framework/App/ErrorHandler.php on line 61