Ad-hsa-let-7f-1-GFP

Catalog number: VR200533
Adenovirus with CMV promoter-driven expression of human pre-miRNA hsa-let-7f-1 in miRNA vector backbone (pMIR) with GFP reporter.
Vector: pMIR
Promoter: CMV
Tag: GFP
$498.00
-
+

Specifications

You are viewing
Ad-hsa-let-7f-1-GFP

What's in the box?
More Information
Item
Volume 100 µl
Titer >1x10^9 vp/mL
Pre-miRNA No. MI0000067
Pre-miRNA Name hsa-let-7f-1
Pre-miRNA Sequence UCAGAGUGAGGUAGUAGAUUGUAUAGUUGUGGGGUAGUGAUUUUACCCUGUUCAGGAGAUAACUAUACAAUCUAUUGCCUUCCCUGA
Mature miRNA 1 No. MIMAT0004486
Mature miRNA 1 Name hsa-let-7f-1-3p
Mature miRNA 1 Sequence CUAUACAAUCUAUUGCCUUCCC
Storage Buffer PBS
Storage Conditions -80°C
Shipping Dry ice
Use Restrictions
For Research Use Only. Not for Use in
Therapeutic or Diagnostic Procedures.
Storage Conditions
-80°C

Resources

Downloads
PDF (809.1 KB)
PDF (96 KB)
PNG (138.9 KB)
DNA (2 MB)
  1. Ad-hsa-mir-5701-2-GFP
    Adenovirus with CMV promoter-driven expression of human pre-miRNA hsa-
  2. Ad-hsa-let-7a-1-GFP
    Adenovirus with CMV promoter-driven expression of human pre-miRNA hsa-
  3. Ad-hsa-let-7a-2-GFP
    Adenovirus with CMV promoter-driven expression of human pre-miRNA hsa-
  4. Ad-hsa-let-7a-3-GFP
    Adenovirus with CMV promoter-driven expression of human pre-miRNA hsa-